Tomato miRNA M00096
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
20 |
1.48 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
31 |
23.89 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
26 |
19.72 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
22 |
15.67 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
5 |
3.68 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
26 |
16.23 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
27 |
17.2 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
21 |
13.84 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
26 |
15.9 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
22 |
13.17 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
90 |
87.81 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
178 |
103.91 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
84 |
82.4 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
325 |
229.85 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
26 |
28.3 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
86 |
82.17 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
39 |
112.66 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
11 |
7.66 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
12 |
16.01 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
4 |
1.13 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
15 |
4.63 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
7 |
1.84 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00096
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand |
sequence | folding
energy | miRNA* | structure |
|---|
| SL2.40ch02 |
39361448 |
39361373 |
- |
AUAUUGGUGCGGUUCAAUUA
GAAAGCGCACUUCUUUAUAU
AUAGAACUUCGUUAUUUAAU
UGAGCCGUGCCAAUAU |
-35.30 |
miRNA* |
structure |
|
