 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00097
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AUAAAGCUGUGGGAAGAUACA | 21 | NA | S08817826 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 52 | 5.07 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 86 | 11.4 |
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 56 | 6.54 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 10 | 2.15 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 172 | 12.69 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 6 | 4.62 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 10 | 7.59 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 16 | 11.4 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 14 | 10.31 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 21 | 13.11 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 7 | 4.46 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 14 | 9.23 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 6 | 3.67 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 7 | 4.19 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 2 | 1.95 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 9 | 5.25 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 12 | 11.77 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 2 | 1.41 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 5 | 5.44 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 1 | 0.96 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 1 | 2.89 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 3 | 2.09 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 11 | 14.68 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 12 | 3.07 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 4 | 1.93 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 11 | 3.39 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 6 | 1.58 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 345 | 103.26 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 253 | 76.57 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 767 | 231.13 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00097
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch00 | 12537513 | 12537624 | + | UGUGUUUUUCCACAGCUUUC UUGAACUGCAUCUACAAUUU CAAUUCAUUAUUGAAAAAGA AAAAAUUGAUUCAUAUUGUU GUUGCGGUUCAAUAAAGCUG UGGGAAGAUACA |
-49.90 | NA | structure |
| SL2.40ch12 | 2905797 | 2905654 | - | UGUACUUUUCCACAGCUUUC UUGAACUGCAUACAUAUAAC AAAAAAAUCUGAUUUUUUUU UGAUUUUUUUUUACUUUUAU AAAGAAAAAAUUUAGAUGGA AAGAAUUAAAUUGUUGCGGU UCAAUAAAGCUGUGGGAAGA UACA |
-47.70 | NA | structure |
