TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00097

sequenceLengthmiRNA familysRNA IDtarget
AUAAAGCUGUGGGAAGAUACA21NA S08817826NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 52 5.07
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 86 11.4
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 56 6.54
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 10 2.15
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 172 12.69
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 6 4.62
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 10 7.59
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 16 11.4
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 14 10.31
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 21 13.11
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 7 4.46
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 14 9.23
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 6 3.67
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 7 4.19
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 2 1.95
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 9 5.25
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 12 11.77
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 2 1.41
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 5 5.44
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 1 0.96
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 1 2.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 3 2.09
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 11 14.68
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 6 1.51
S0712 Solanum lycopersicum MicroTom fruit , mature green 12 3.07
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 4 1.93
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 1 0.83
S0708 Solanum lycopersicum MicroTom flower, open 11 3.39
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 6 1.58
S0373 Solanum lycopersicum Heinz 1706 fruit 345 103.26
S0372 Solanum lycopersicum Heinz 1706 flower 253 76.57
S0371 Solanum lycopersicum Heinz 1706 leaf 767 231.13

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00097

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch00 12537513 12537624 + UGUGUUUUUCCACAGCUUUC
UUGAACUGCAUCUACAAUUU
CAAUUCAUUAUUGAAAAAGA
AAAAAUUGAUUCAUAUUGUU
GUUGCGGUUCAAUAAAGCUG
UGGGAAGAUACA
-49.90 NA structure
SL2.40ch12 2905797 2905654 - UGUACUUUUCCACAGCUUUC
UUGAACUGCAUACAUAUAAC
AAAAAAAUCUGAUUUUUUUU
UGAUUUUUUUUUACUUUUAU
AAAGAAAAAAUUUAGAUGGA
AAGAAUUAAAUUGUUGCGGU
UCAAUAAAGCUGUGGGAAGA
UACA
-47.70 NA structure