Tomato miRNA M00099
| sequence | Length | miRNA family | sRNA ID | target |
| UGAUGUACAUGGGAUGGAUUA | 21 | NA |
S23390315 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
652 |
48.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
32 |
9.87 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
12 |
3.15 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
5 |
1.5 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
200 |
60.53 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
779 |
234.75 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00099
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch01 |
3821657 |
3821778 |
+ |
UGAUGUACAUGGGAUGGAUU
ACAACUUGAUUAGAAAACAU
UGGACACAAUACUUCAAAAC
UUCCCAAAAACGGUCUUAUG
GAAUGCGAGUAGAGAUUGUU
GUACUUUCUCUCCCUGAUGU
CA |
-22.90 |
NA |
structure |
|