Tomato miRNA M00101
| sequence | Length | miRNA family | sRNA ID | target |
| CGGUUCAAUAAAGCUGUGGGA | 21 | NA |
S14134810 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
24 |
2.34 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
9 |
1.19 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
18 |
2.1 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
4 |
0.86 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
16 |
12.33 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
20 |
15.17 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
7 |
4.99 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
7 |
5.16 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
31 |
19.36 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
17 |
10.83 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
38 |
25.04 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
9 |
5.5 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
6 |
3.59 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
46 |
44.88 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
39 |
22.77 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
76 |
74.55 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
52 |
36.78 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
171 |
186.15 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
309 |
295.24 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
38 |
109.77 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
6 |
4.18 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1 |
1.33 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
12 |
3.02 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
7 |
1.79 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2 |
0.62 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00101
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch00 |
12537520 |
12537617 |
+ |
UUCCACAGCUUUCUUGAACU
GCAUCUACAAUUUCAAUUCA
UUAUUGAAAAAGAAAAAAUU
GAUUCAUAUUGUUGUUGCGG
UUCAAUAAAGCUGUGGGA |
-40.30 |
miRNA* |
structure |
| SL2.40ch12 |
2905790 |
2905661 |
- |
UUCCACAGCUUUCUUGAACU
GCAUACAUAUAACAAAAAAA
UCUGAUUUUUUUUUGAUUUU
UUUUUACUUUUAUAAAGAAA
AAAUUUAGAUGGAAAGAAUU
AAAUUGUUGCGGUUCAAUAA
AGCUGUGGGA |
-42.20 |
miRNA* |
structure |
|