TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00101

sequenceLengthmiRNA familysRNA IDtarget
CGGUUCAAUAAAGCUGUGGGA21NA S14134810NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 24 2.34
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 9 1.19
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 18 2.1
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 4 0.86
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 16 12.33
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 20 15.17
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 7 4.99
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 7 5.16
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 31 19.36
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 17 10.83
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 38 25.04
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 9 5.5
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 6 3.59
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 46 44.88
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 39 22.77
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 76 74.55
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 52 36.78
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 171 186.15
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 309 295.24
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 38 109.77
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 6 4.18
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 1 1.33
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 12 3.02
S0712 Solanum lycopersicum MicroTom fruit , mature green 7 1.79
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 3 1.45
S0708 Solanum lycopersicum MicroTom flower, open 2 0.62
S0371 Solanum lycopersicum Heinz 1706 leaf 1 0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00101

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch00 12537520 12537617 + UUCCACAGCUUUCUUGAACU
GCAUCUACAAUUUCAAUUCA
UUAUUGAAAAAGAAAAAAUU
GAUUCAUAUUGUUGUUGCGG
UUCAAUAAAGCUGUGGGA
-40.30 miRNA* structure
SL2.40ch12 2905790 2905661 - UUCCACAGCUUUCUUGAACU
GCAUACAUAUAACAAAAAAA
UCUGAUUUUUUUUUGAUUUU
UUUUUACUUUUAUAAAGAAA
AAAUUUAGAUGGAAAGAAUU
AAAUUGUUGCGGUUCAAUAA
AGCUGUGGGA
-42.20 miRNA* structure