Tomato miRNA M00108
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
30 |
2.92 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
71 |
9.41 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
72 |
8.41 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
6 |
1.29 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
880 |
64.91 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
107 |
44.74 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
23 |
23.52 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
146 |
36.75 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
44 |
12.47 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
114 |
29.17 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
116 |
35.79 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
32 |
8.4 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
355 |
106.26 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
130 |
39.34 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1528 |
460.45 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00108
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch11 |
36953069 |
36952876 |
- |
UGUGAGAUGGUAAUAACGGU
GAUAAUGGUAUUCUAAUAUU
GCUAAAGUUAGACAGAUUUA
CUGCCUUUUGUUAUUUCAGA
UGCAGGAACACCAAUACAAG
AAGCAAUGAGCUUGCUUGGG
CAUGUCAAAAGCCGUAAAUC
CAUUCAAUUUUAGCAAUAUU
GGAAUACCAUCAUCACCGUU
AUUACCACCUGGCA |
-89.61 |
miRNA* |
structure |
|