Tomato miRNA M00109
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
17 |
1.66 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
15 |
1.99 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
11443 |
844.03 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
9 |
3.76 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
5 |
1.26 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
154 |
46.09 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
12 |
3.63 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
31 |
9.34 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00109
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch08 |
56132648 |
56132786 |
+ |
UUUUCAGUAGACGUUGUGAA
UAAUUGAUAAAUACAGGUAU
ACAGAGGUCUUAAUAUAGUC
AGAACCUAGAAAUAUGUGUA
ACUAGAUUCAGACCUUUGUA
CACUUGUAUUCUGUUGCUAU
UCACAAUCUCUGCUGAAAA |
-58.20 |
NA |
structure |
|