Tomato miRNA M00110
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
2 |
0.19 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
4 |
0.86 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
12600 |
929.37 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
5 |
1.28 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
31 |
9.56 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
16 |
4.2 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
108 |
32.33 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
618 |
187.03 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
74 |
22.3 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00110
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch08 |
59305785 |
59305677 |
- |
UAACCCCGAUAAAAUCUAAG
UUUCCAAAGGCUUUAAUGUU
ACUCGUCAAGUAAAUGGUGA
UGAGUUGGUAAUGUUAAGGU
UUUUGGAAUCUUGGAUUUUA
UCGGAGUUA |
-52.00 |
NA |
structure |
|