Tomato miRNA M00111
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
113 |
11.01 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
77 |
10.21 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
61 |
7.13 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
23 |
4.95 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
42748 |
3153.09 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
1 |
1.02 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
13 |
3.27 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
6 |
1.7 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
5 |
1.28 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1259 |
376.84 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
111 |
33.59 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
172 |
51.83 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00111
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch08 |
56132649 |
56132785 |
+ |
UUUCAGUAGACGUUGUGAAU
AAUUGAUAAAUACAGGUAUA
CAGAGGUCUUAAUAUAGUCA
GAACCUAGAAAUAUGUGUAA
CUAGAUUCAGACCUUUGUAC
ACUUGUAUUCUGUUGCUAUU
CACAAUCUCUGCUGAAA |
-57.30 |
NA |
structure |
|