Tomato miRNA M00117
| sequence | Length | miRNA family | sRNA ID | target |
| UGAACCUGCAUCGUGAUGGCCU | 22 | NA |
S22951927 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
8 |
0.78 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
6 |
0.8 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
7 |
0.82 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1478 |
109.02 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
78 |
32.62 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
12 |
12.27 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
147 |
37 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
104 |
29.48 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
220 |
56.28 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
43 |
20.71 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
45 |
37.38 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
67 |
37.99 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
272 |
83.92 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
226 |
59.33 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
275 |
82.31 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
203 |
61.44 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
327 |
98.54 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00117
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
61427691 |
61427824 |
+ |
UGAACCUGCAUCGUGAUGGC
CUGUGCCAUCUGGGUUAGAG
AUGCUCUCACCUCAAAUCAG
AAUAAUAAGUCCACAUCAAC
CAUAUUAAGGGCAUCUCUAG
CCCAGAUGGCACAUGCCAUC
ACGAUGUAGGCUCA |
-83.00 |
NA |
structure |
|