Tomato miRNA M00118
| sequence | Length | miRNA family | sRNA ID | target |
| UAGCCUGAACCUGCAUCGUGAU | 22 | NA |
S21095492 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
35 |
4.09 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
9 |
1.94 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1604 |
118.31 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2 |
0.84 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
2 |
0.57 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
1 |
0.26 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
16 |
4.94 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
8 |
2.1 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
156 |
46.69 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
94 |
28.45 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
203 |
61.17 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00118
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
61427686 |
61427829 |
+ |
UAGCCUGAACCUGCAUCGUG
AUGGCCUGUGCCAUCUGGGU
UAGAGAUGCUCUCACCUCAA
AUCAGAAUAAUAAGUCCACA
UCAACCAUAUUAAGGGCAUC
UCUAGCCCAGAUGGCACAUG
CCAUCACGAUGUAGGCUCAG
GCUA |
-95.10 |
miRNA* |
structure |
|