TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00128

sequenceLengthmiRNA familysRNA IDtarget
UGGCAGGAAGACAUGAGGCAUU22NA S23737564NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1 0.22
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 2 0.15
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 289 222.71
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 137 103.93
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 138 98.32
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 177 130.36
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 317 197.94
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 344 219.14
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 301 198.37
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 351 214.58
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 414 247.83
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 27 26.34
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 108 63.05
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 44 43.16
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 87 61.53
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 18 19.59
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 279 194.36
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 194 258.88
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 89 37.22
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 21 21.47
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 119 29.95
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 135 38.26
S0712 Solanum lycopersicum MicroTom fruit , mature green 272 69.59
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 335 161.37
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 258 214.33
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 375 212.63
S0708 Solanum lycopersicum MicroTom flower, open 528 162.91
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 1101 289.04
S0373 Solanum lycopersicum Heinz 1706 fruit 2 0.6
S0372 Solanum lycopersicum Heinz 1706 flower 17 5.14
S0371 Solanum lycopersicum Heinz 1706 leaf 2 0.6

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00128

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch04 4907568 4907641 + UGGCAGGAAGACAUGAGGCA
UU
AGUAUGUAUAUUGUGUAA
AUUUUAAAUACUAAUGCCUC
AUGCCUUCCUGCCA
-44.80 NA structure