Tomato miRNA M00128
| sequence | Length | miRNA family | sRNA ID | target |
|---|
| UGGCAGGAAGACAUGAGGCAUU | 22 | NA |
S23737564 | NA |
Digital expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2 |
0.15 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
289 |
222.71 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
137 |
103.93 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
138 |
98.32 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
177 |
130.36 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
317 |
197.94 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
344 |
219.14 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
301 |
198.37 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
351 |
214.58 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
414 |
247.83 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
27 |
26.34 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
108 |
63.05 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
44 |
43.16 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
87 |
61.53 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
18 |
19.59 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
279 |
194.36 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
194 |
258.88 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
89 |
37.22 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
21 |
21.47 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
119 |
29.95 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
135 |
38.26 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
272 |
69.59 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
335 |
161.37 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
258 |
214.33 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
375 |
212.63 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
528 |
162.91 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1101 |
289.04 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
2 |
0.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
17 |
5.14 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00128
| genome hit of precursor | precursor |
|---|
| sequence ID | start | end | strand |
sequence | folding
energy | miRNA* | structure |
|---|
| SL2.40ch04 |
4907568 |
4907641 |
+ |
UGGCAGGAAGACAUGAGGCA
UUAGUAUGUAUAUUGUGUAA
AUUUUAAAUACUAAUGCCUC
AUGCCUUCCUGCCA |
-44.80 |
NA |
structure |
|
