Tomato miRNA M00129
| sequence | Length | miRNA family | sRNA ID | target |
| UCUCAGUCGGAAGAGGGGGAAG | 22 | NA |
S22616278 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
5 |
0.49 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
10 |
1.33 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
30 |
3.5 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
5 |
1.08 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2960 |
218.33 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
5 |
2.09 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
4 |
1.01 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2 |
0.51 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2 |
0.62 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
1 |
0.26 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
286 |
85.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
314 |
95.03 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
976 |
294.11 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00129
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch06 |
32482731 |
32482864 |
+ |
CAUCCUCCUCUUCCGACUGA
GAAUUGCAAAGGUAAAGUGA
AAGCGACUAAUGCUAAGGAG
GAAGUUUUGCACAUAACCUU
AGCAUUAGUCGCUUUCACUU
UUCCUUUGCAAUUCUCAGUC
GGAAGAGGGGGAAG |
-100.57 |
NA |
structure |
|