Tomato miRNA M00131
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
736 |
71.72 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2573 |
341.04 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
249 |
29.09 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
35 |
7.54 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
244 |
18 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
1 |
0.25 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
5 |
1.42 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
15 |
3.84 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
33 |
10.18 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
11 |
2.89 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
149 |
44.6 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
35 |
10.59 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
86 |
25.92 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00131
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch05 |
60646173 |
60646260 |
+ |
UGAAUGCAAUGUCAUAUACC
AUCAACACUUGGAAACUCAA
AUUGAGGUUAAAUCUCGGAG
UGAUGAUGGUAUAUGACCUU
GCAAUUCA |
-40.00 |
NA |
structure |
|