TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00137

sequenceLengthmiRNA familysRNA IDtarget
AAAGUGAGACGAACAAAUUGAAU23NA S01089747click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 3 0.29
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 5 0.66
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 5 0.58
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 2 0.43
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 39 2.88
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 18 7.53
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 41 10.32
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 12 3.4
S0712 Solanum lycopersicum MicroTom fruit , mature green 56 14.33
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 88 42.39
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 58 48.18
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 214 121.34
S0708 Solanum lycopersicum MicroTom flower, open 13 4.01
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 43 11.29
S0373 Solanum lycopersicum Heinz 1706 fruit 24 7.18
S0372 Solanum lycopersicum Heinz 1706 flower 26 7.87
S0371 Solanum lycopersicum Heinz 1706 leaf 6 1.81

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00137

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch01 831473 831534 + GUUCAAUUUGUUUGCCCUAC
UUUACUUUUAAAGUAAAGUA
AAGUGAGACGAACAAAUUGA
AU
-26.40 miRNA* structure