Tomato miRNA M00137
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3 |
0.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
5 |
0.66 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
5 |
0.58 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
39 |
2.88 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
18 |
7.53 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
41 |
10.32 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
12 |
3.4 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
56 |
14.33 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
88 |
42.39 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
58 |
48.18 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
214 |
121.34 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
13 |
4.01 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
43 |
11.29 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
24 |
7.18 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
26 |
7.87 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
6 |
1.81 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00137
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch01 |
831473 |
831534 |
+ |
GUUCAAUUUGUUUGCCCUAC
UUUACUUUUAAAGUAAAGUA
AAGUGAGACGAACAAAUUGA
AU |
-26.40 |
miRNA* |
structure |
|