 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00140
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| GCUGACGGCAUUAGAUUGAUAUA | 23 | NA | S17569846 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 1 | 0.12 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 4 | 0.3 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 79 | 60.88 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 73 | 55.38 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 73 | 52.01 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 87 | 64.07 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 89 | 55.57 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 59 | 37.59 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 55 | 36.25 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 85 | 51.96 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 79 | 47.29 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 71 | 69.27 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 108 | 63.05 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 68 | 66.7 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 33 | 23.34 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 60 | 65.32 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 41 | 39.17 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 46 | 132.88 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 98 | 68.27 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 100 | 133.44 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 113 | 47.25 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 34 | 34.77 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 103 | 25.93 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 189 | 53.57 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 118 | 30.19 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 24 | 11.56 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 22 | 18.28 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 6 | 3.4 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 40 | 12.34 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 47 | 12.34 |
| S0373 | Solanum lycopersicum | Heinz 1706 | fruit | 1 | 0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00140
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch01 | 5704069 | 5703914 | - | GCUGACGGCAUUAGAUUGAU AUAUGUUACUCACAGUAAUG UUUUACUCAUAAUACGUUAC UUACAGUAACGUUUUAGGCG UAAAACGUUACUCAAAAUAA CGUUUUAGGAGUAAAACCGU AUUUACAGUAACGUAUAUCA ACCUAACACUGUUAGU |
-63.00 | NA | structure |
