Tomato miRNA M00140
| sequence | Length | miRNA family | sRNA ID | target |
| GCUGACGGCAUUAGAUUGAUAUA | 23 | NA |
S17569846 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
4 |
0.3 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
79 |
60.88 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
73 |
55.38 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
73 |
52.01 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
87 |
64.07 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
89 |
55.57 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
59 |
37.59 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
55 |
36.25 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
85 |
51.96 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
79 |
47.29 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
71 |
69.27 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
108 |
63.05 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
68 |
66.7 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
33 |
23.34 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
60 |
65.32 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
41 |
39.17 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
46 |
132.88 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
98 |
68.27 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
100 |
133.44 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
113 |
47.25 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
34 |
34.77 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
103 |
25.93 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
189 |
53.57 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
118 |
30.19 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
24 |
11.56 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
22 |
18.28 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
6 |
3.4 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
40 |
12.34 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
47 |
12.34 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00140
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch01 |
5704069 |
5703914 |
- |
GCUGACGGCAUUAGAUUGAU
AUAUGUUACUCACAGUAAUG
UUUUACUCAUAAUACGUUAC
UUACAGUAACGUUUUAGGCG
UAAAACGUUACUCAAAAUAA
CGUUUUAGGAGUAAAACCGU
AUUUACAGUAACGUAUAUCA
ACCUAACACUGUUAGU |
-63.00 |
NA |
structure |
|