TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00141

sequenceLengthmiRNA familysRNA IDtarget
UGGACGGCGAGGACAUGAGUGAA23NA S23636860NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 1 0.12
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 1 0.22
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 134 103.26
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 98 74.34
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 134 95.47
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 150 110.47
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 123 76.8
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 121 77.08
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 159 104.79
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 159 97.2
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 224 134.09
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 17 16.59
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 40 23.35
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 31 30.41
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 31 21.92
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 49 53.34
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 36 34.4
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 12 34.66
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 159 110.77
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 101 134.78
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 9 3.76
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3 3.07
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 15 3.78
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 46 13.04
S0712 Solanum lycopersicum MicroTom fruit , mature green 38 9.72
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 38 18.3
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 24 19.94
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 28 15.88
S0708 Solanum lycopersicum MicroTom flower, open 11 3.39
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 63 16.54
S0371 Solanum lycopersicum Heinz 1706 leaf 1 0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00141

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch02 33638942 33638832 - UUCACUCAUGUUUUCGCCAU
CCAACUUUUGGUUCAUGUAU
GUCCAACAUGGCAACUAACG
CCUAUAAAGGCAUAUUUGCA
CCAAAAGUUGGACGGCGAGG
ACAUGAGUGAA		 -64.80 NA structure