Tomato miRNA M00143
| sequence | Length | miRNA family | sRNA ID | target |
| AUGGCAGAGACAAUACCUGAGUA | 23 | NA |
S11184186 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3 |
0.22 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
21 |
16.18 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
13 |
9.86 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
2 |
1.42 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
6 |
4.42 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
14 |
8.74 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
5 |
3.19 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
9 |
5.93 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
7 |
4.28 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
5 |
2.99 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
124 |
120.99 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
226 |
131.93 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
143 |
140.27 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
119 |
84.16 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
43 |
46.81 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
54 |
51.59 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
20 |
57.77 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
1 |
0.7 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
6 |
8.01 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3 |
3.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
6 |
1.51 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
12 |
3.4 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
39 |
9.98 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
21 |
6.48 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
26 |
6.83 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00143
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch02 |
49238753 |
49238937 |
+ |
UAUUCAGGUAUUGUCUCUGC
CAUUGGCGGCCAUUCGCUCU
UUUAAUCCCCUCUUAUUGGC
UUGCUGCCUCAAGGGAAUGU
AAAGGAGCCAUAGGUCACGG
GUUCGAUUCUCCCUUGAGGC
UGCGAGCCAAUAAGAGGGGA
UUAAAAGAGCGAAUGGCCGC
CCAUGGCAGAGACAAUACCU
GAGUA |
-153.20 |
NA |
structure |
|