 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00143
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| AUGGCAGAGACAAUACCUGAGUA | 23 | NA | S11184186 | NA |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0737 | Solanum lycopersicum | Ailsa Craig | fruit, mature green (39 days after anthesis) | 3 | 0.35 |
| S0736 | Solanum lycopersicum | Ailsa Craig | fruit, immature (17 days after anthesis) | 1 | 0.22 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 3 | 0.22 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 21 | 16.18 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 13 | 9.86 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 2 | 1.42 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 6 | 4.42 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 14 | 8.74 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 5 | 3.19 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 9 | 5.93 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 7 | 4.28 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 5 | 2.99 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 124 | 120.99 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 226 | 131.93 |
| S0723 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate1 | 143 | 140.27 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 119 | 84.16 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 43 | 46.81 |
| S0720 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate2 | 54 | 51.59 |
| S0719 | Solanum pennellii | LA716 | seedlings, two-week-old , replicate1 | 20 | 57.77 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 1 | 0.7 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 6 | 8.01 |
| S0716 | Solanum lycopersicum | MicroTom | fruit , 7 days post breaker | 4 | 1.67 |
| S0715 | Solanum lycopersicum | MicroTom | fruit , 5 days post breaker | 3 | 3.07 |
| S0714 | Solanum lycopersicum | MicroTom | fruit , 3 days post breaker | 6 | 1.51 |
| S0713 | Solanum lycopersicum | MicroTom | fruit , breaker stage | 12 | 3.4 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 39 | 9.98 |
| S0711 | Solanum lycopersicum | MicroTom | fruit , 11mm to 14mm in diameter | 3 | 1.45 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 7 | 5.82 |
| S0709 | Solanum lycopersicum | MicroTom | fruit , 1mm to 3mm in diameter | 2 | 1.13 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 21 | 6.48 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 26 | 6.83 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00143
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch02 | 49238753 | 49238937 | + | UAUUCAGGUAUUGUCUCUGC CAUUGGCGGCCAUUCGCUCU UUUAAUCCCCUCUUAUUGGC UUGCUGCCUCAAGGGAAUGU AAAGGAGCCAUAGGUCACGG GUUCGAUUCUCCCUUGAGGC UGCGAGCCAAUAAGAGGGGA UUAAAAGAGCGAAUGGCCGC CCAUGGCAGAGACAAUACCU GAGUA |
-153.20 | NA | structure |
