TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00148

sequenceLengthmiRNA familysRNA IDtarget
UUCGGACAUAGGUUGAGAGGGUA23NA S25120647click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 9 0.88
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 11 1.29
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 3 0.65
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 21 1.55
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 396 305.16
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 332 251.86
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 197 140.35
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 223 164.23
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 393 245.39
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 358 228.06
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 452 297.89
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 734 448.73
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 621 371.74
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 104 101.47
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 174 101.58
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 109 106.92
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 81 57.29
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 155 168.73
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 100 95.55
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 16 46.22
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 329 229.19
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 203 270.89
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 87 36.38
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 59 60.33
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 183 46.06
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 353 100.05
S0712 Solanum lycopersicum MicroTom fruit , mature green 174 44.52
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 92 44.32
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 66 54.83
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 29 16.44
S0708 Solanum lycopersicum MicroTom flower, open 91 28.08
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 58 15.23
S0373 Solanum lycopersicum Heinz 1706 fruit 5 1.5
S0372 Solanum lycopersicum Heinz 1706 flower 1 0.3

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00148

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch05 1507834 1507718 - UACCCCCUUAAUCUAUGCCA
GAAAUCUCAGAGACACUUAU
ACUAUACUAAGGGGGUAAUA
GGACCACAAUAUAGUAUAAG
UGUGUCUCUGAGAUUUCGGA
CAUAGGUUGAGAGGGUA		 -61.70 NA structure