Tomato miRNA M00153
| sequence | Length | miRNA family | sRNA ID | target |
| UUGAAUGUUGGGGAACGAACGUCU | 24 | NA |
S25335887 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
55 |
5.36 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
36 |
4.77 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
864 |
100.93 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
120 |
25.84 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
65 |
4.79 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
13 |
5.44 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
21 |
5.29 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
32 |
9.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
19 |
4.86 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
14 |
11.63 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
10 |
5.67 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
21 |
6.48 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
44 |
11.55 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
68 |
20.35 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
28 |
8.47 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
15 |
4.52 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00153
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch09 |
3057927 |
3057788 |
- |
UUGAAUGUUGGGGAACGAAC
GUCUAAGGUUUGGGUCAACG
AUCUCAAUGUUGAUGCGUCC
GCUUGUUGUUGAUGCUGCUC
CAAAAGGUUCAACAUUGGGA
UUUUAGCCCAAACAUCAGAC
GUCCCUUCCCCAUCGUUCAA
|
-67.10 |
NA |
structure |
|