Tomato miRNA M00157
| sequence | Length | miRNA family | sRNA ID | target |
| CAUGGCAGAGACAAUACCUGAAUA | 24 | NA |
S13318084 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
21 |
1.55 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
19 |
14.64 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
36 |
27.31 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
23 |
16.39 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
40 |
29.46 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
48 |
29.97 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
17 |
10.83 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
33 |
21.75 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
42 |
25.68 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
32 |
19.16 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
76 |
74.15 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
57 |
33.28 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
114 |
111.83 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
78 |
55.16 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
35 |
38.1 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
83 |
79.3 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
36 |
103.99 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
10 |
6.97 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
12 |
16.01 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
4 |
1.67 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
10 |
2.52 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
7 |
1.98 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
15 |
3.84 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
11 |
9.14 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
7 |
3.97 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
36 |
11.11 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
31 |
8.14 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3 |
0.9 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
5 |
1.51 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00157
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch10 |
64094132 |
64094355 |
+ |
UAUUCAGGUAUAGUCUCUGC
CAUGGGCGGCCAUUCGCUCU
UUUAAUCCCCUCUUAUUGGC
AUGCAGCCUCAAGGGAGAAU
CGAACCCGUGACCUAUGGCU
CCUUUACAUCCCUCCCAAGG
AGAUCGCCUUUCACCAAUUA
AGCUGCAGCUCCUUGAGGCU
GCAUGCCAAUAAGAGGGGAU
UAAAAGAGCGAAUGGCCGCC
CAUGGCAGAGACAAUACCUG
AAUA |
-161.20 |
NA |
structure |
|