TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00157

sequenceLengthmiRNA familysRNA IDtarget
CAUGGCAGAGACAAUACCUGAAUA24NA S13318084NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 21 1.55
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 19 14.64
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 36 27.31
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 23 16.39
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 40 29.46
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 48 29.97
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 17 10.83
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 33 21.75
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 42 25.68
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 32 19.16
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 76 74.15
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 57 33.28
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 114 111.83
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 78 55.16
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 35 38.1
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 83 79.3
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 36 103.99
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 10 6.97
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 12 16.01
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 4 1.67
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 10 2.52
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 7 1.98
S0712 Solanum lycopersicum MicroTom fruit , mature green 15 3.84
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 3 1.45
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 11 9.14
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 7 3.97
S0708 Solanum lycopersicum MicroTom flower, open 36 11.11
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 31 8.14
S0373 Solanum lycopersicum Heinz 1706 fruit 3 0.9
S0372 Solanum lycopersicum Heinz 1706 flower 5 1.51
S0371 Solanum lycopersicum Heinz 1706 leaf 2 0.6

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00157

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch10 64094132 64094355 + UAUUCAGGUAUAGUCUCUGC
CAUGGGCGGCCAUUCGCUCU
UUUAAUCCCCUCUUAUUGGC
AUGCAGCCUCAAGGGAGAAU
CGAACCCGUGACCUAUGGCU
CCUUUACAUCCCUCCCAAGG
AGAUCGCCUUUCACCAAUUA
AGCUGCAGCUCCUUGAGGCU
GCAUGCCAAUAAGAGGGGAU
UAAAAGAGCGAAUGGCCGCC
CAUGGCAGAGACAAUACCUG
AAUA
-161.20 NA structure