TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00160

sequenceLengthmiRNA familysRNA IDtarget
GUUGACGGCGUUAGAUUGAUAUAC24NA S19943157NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 11 0.81
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 27 20.81
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 14 10.62
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 22 15.67
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 41 30.2
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 57 35.59
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 27 17.2
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 20 13.18
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 39 23.84
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 31 18.56
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 22 21.47
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 39 22.77
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 8 7.85
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 33 23.34
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 47 51.16
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 68 64.97
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 42 121.33
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 77 53.64
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 37 49.37
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 2 0.84
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 5 5.11
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 9 2.27
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 14 3.97
S0712 Solanum lycopersicum MicroTom fruit , mature green 22 5.63
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 5 2.41
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 3 2.49
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 2 1.13
S0708 Solanum lycopersicum MicroTom flower, open 12 3.7
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 39 10.24

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00160

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch02 42047751 42047844 + GUUGACGGCGUUAGAUUGAU
AUAC
GUUACUCAAAAUGACU
UUUUAGAAGUAAAGCGUUAC
UUACAGUUACGUAUAUCAAC
CUAACGCUAUUAAU
-33.50 NA structure
SL2.40ch02 29507558 29507434 - GUUGACGGCGUUAGAUUGAU
AUAC
GUUACUCACAGUAACG
UUUUACUCGUGAAACGUUAU
UGUGAGUAACGUCUUACUCU
UAAAACGUUACUCAGAGUAA
CGUAUAUCAACCUAACGCUG
UUAGU
-69.30 NA structure