Tomato miRNA M00160
| sequence | Length | miRNA family | sRNA ID | target |
| GUUGACGGCGUUAGAUUGAUAUAC | 24 | NA |
S19943157 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
11 |
0.81 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
27 |
20.81 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
14 |
10.62 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
22 |
15.67 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
41 |
30.2 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
57 |
35.59 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
27 |
17.2 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
20 |
13.18 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
39 |
23.84 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
31 |
18.56 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
22 |
21.47 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
39 |
22.77 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
8 |
7.85 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
33 |
23.34 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
47 |
51.16 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
68 |
64.97 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
42 |
121.33 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
77 |
53.64 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
37 |
49.37 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2 |
0.84 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
5 |
5.11 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
9 |
2.27 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
14 |
3.97 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
22 |
5.63 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
5 |
2.41 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2 |
1.13 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
12 |
3.7 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
39 |
10.24 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00160
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch02 |
42047751 |
42047844 |
+ |
GUUGACGGCGUUAGAUUGAU
AUACGUUACUCAAAAUGACU
UUUUAGAAGUAAAGCGUUAC
UUACAGUUACGUAUAUCAAC
CUAACGCUAUUAAU |
-33.50 |
NA |
structure |
| SL2.40ch02 |
29507558 |
29507434 |
- |
GUUGACGGCGUUAGAUUGAU
AUACGUUACUCACAGUAACG
UUUUACUCGUGAAACGUUAU
UGUGAGUAACGUCUUACUCU
UAAAACGUUACUCAGAGUAA
CGUAUAUCAACCUAACGCUG
UUAGU |
-69.30 |
NA |
structure |
|