 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
 |
Tomato miRNA M00161
| sequence | Length | miRNA family | sRNA ID | target |
|---|---|---|---|---|
| ACAAGCAAAUUGAAACGGACUGGA | 24 | NA | S04366326 | click here |
Digital expression
| Sample | No. raw reads | RPM | |||
|---|---|---|---|---|---|
| ID | Organism | Cultivar | Tissue | ||
| S0739 | Solanum lycopersicum | Ailsa Craig | fruit, red ripe (52 days after anthesis) | 4 | 0.39 |
| S0738 | Solanum lycopersicum | Ailsa Craig | fruit, breaker (42 days after anthesis) | 1 | 0.13 |
| S0735 | Solanum lycopersicum | Sunny | leaf , TSWV-infected | 51 | 3.76 |
| S0734 | Solanum lycopersicum | IL8-3-1 | seedlings, two-week-old | 162 | 124.84 |
| S0733 | Solanum lycopersicum | IL8-3 | seedlings, two-week-old | 58 | 44 |
| S0732 | Solanum lycopersicum | IL8-2-1 | seedlings, two-week-old | 66 | 47.02 |
| S0731 | Solanum lycopersicum | IL8-2 | seedlings, two-week-old | 51 | 37.56 |
| S0730 | Solanum lycopersicum | IL8-1-3 | seedlings, two-week-old | 82 | 51.2 |
| S0729 | Solanum lycopersicum | IL8-1D | seedlings, two-week-old | 82 | 52.24 |
| S0728 | Solanum lycopersicum | IL8-1-1 | seedlings, two-week-old | 90 | 59.31 |
| S0727 | Solanum lycopersicum | IL2-5 | seedlings, two-week-old | 74 | 45.24 |
| S0726 | Solanum lycopersicum | IL1-1 | seedlings, two-week-old | 79 | 47.29 |
| S0725 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate3 | 6 | 5.85 |
| S0724 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F2) | seedlings, two-week-old , replicate2 | 24 | 14.01 |
| S0722 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate2 | 29 | 20.51 |
| S0721 | Solanum lycopersicum x S. pennellii | M82 x LA716 (F1) | seedlings, two-week-old , replicate1 | 27 | 29.39 |
| S0718 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate2 | 42 | 29.26 |
| S0717 | Solanum lycopersicum | M82 | seedlings, two-week-old , replicate1 | 16 | 21.35 |
| S0712 | Solanum lycopersicum | MicroTom | fruit , mature green | 3 | 0.77 |
| S0710 | Solanum lycopersicum | MicroTom | fruit , 5mm to 7mm in diameter | 1 | 0.83 |
| S0708 | Solanum lycopersicum | MicroTom | flower, open | 1 | 0.31 |
| S0707 | Solanum lycopersicum | MicroTom | flower bud, closed bud before flower blooming | 4 | 1.05 |
| S0372 | Solanum lycopersicum | Heinz 1706 | flower | 4 | 1.21 |
| S0371 | Solanum lycopersicum | Heinz 1706 | leaf | 4 | 1.21 |
Hits on known miRNAs
| No hits on known miRNAs were found |
Precursor of miRNA M00161
| genome hit of precursor | precursor | ||||||
|---|---|---|---|---|---|---|---|
| sequence ID | start | end | strand | sequence | folding energy | miRNA* | structure |
| SL2.40ch06 | 36014892 | 36015052 | + | UCCCUCUGUUUCAAUUUGUU UGUCUGGCUUUGACAUGACA CAAAGUUUAGGAAAGUAAAA AAUACUUUUGAAUCUUGUGA UCUUAAACAUGUCACGUGAA AAGUUGAAAUUAAAGAGUUG CAAAAAAGGAAAGUAAGACA AGCAAAUUGAAACGGACUGG A |
-51.40 | NA | structure |
