TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00163

sequenceLengthmiRNA familysRNA IDtarget
AAGAUAGACUUGUUUGACUCUUGA24NA S02465474NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 28 2.07
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 18 13.87
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 13 9.86
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 3 2.14
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 3 2.21
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 8 5
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 30 19.11
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 28 18.45
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 13 7.95
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 20 11.97
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 77 75.13
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 227 132.52
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 108 105.94
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 137 96.89
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 47 51.16
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 70 66.88
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 5 14.44
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 23 16.02
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 6 8.01
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 1 0.42
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 1 0.28
S0712 Solanum lycopersicum MicroTom fruit , mature green 2 0.51
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 11 5.3
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 3 2.49
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 13 7.37
S0708 Solanum lycopersicum MicroTom flower, open 25 7.71
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 65 17.06
S0372 Solanum lycopersicum Heinz 1706 flower 2 0.61

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00163

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch03 23984834 23984651 - UUAAGAGUCAAACAAUUUAA
GUUUGAUCGAAAAUUUGCGG
AUGGAAUCUUUAAUUUUUUU
AAAUGAAAUUUAUAUAUUUA
UAAACUGCAUAAAAGGUAUU
AUGAGUCAUAAUAAUGGAUA
AUUCUAAUUGUUUAAAAGAU
CUAUGAAUUAUUUACGGGCA
AAGAUAGACUUGUUUGACUC
UUGA
-39.60 NA structure