Tomato miRNA M00163
| sequence | Length | miRNA family | sRNA ID | target |
| AAGAUAGACUUGUUUGACUCUUGA | 24 | NA |
S02465474 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
28 |
2.07 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
18 |
13.87 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
13 |
9.86 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
3 |
2.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
3 |
2.21 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
8 |
5 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
30 |
19.11 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
28 |
18.45 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
13 |
7.95 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
20 |
11.97 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
77 |
75.13 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
227 |
132.52 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
108 |
105.94 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
137 |
96.89 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
47 |
51.16 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
70 |
66.88 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
5 |
14.44 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
23 |
16.02 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
6 |
8.01 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
1 |
0.42 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
1 |
0.28 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2 |
0.51 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
11 |
5.3 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
13 |
7.37 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
25 |
7.71 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
65 |
17.06 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00163
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
23984834 |
23984651 |
- |
UUAAGAGUCAAACAAUUUAA
GUUUGAUCGAAAAUUUGCGG
AUGGAAUCUUUAAUUUUUUU
AAAUGAAAUUUAUAUAUUUA
UAAACUGCAUAAAAGGUAUU
AUGAGUCAUAAUAAUGGAUA
AUUCUAAUUGUUUAAAAGAU
CUAUGAAUUAUUUACGGGCA
AAGAUAGACUUGUUUGACUC
UUGA |
-39.60 |
NA |
structure |
|