Tomato miRNA M00170
| sequence | Length | miRNA family | sRNA ID | target |
| AUAUGACGGCAGGAACAUCAAUGU | 24 | NA |
S09954219 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
3 |
0.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
3 |
0.4 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
9 |
0.66 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
205 |
157.98 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
179 |
135.79 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
194 |
138.21 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
221 |
162.76 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
176 |
109.9 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
194 |
123.59 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
250 |
164.76 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
254 |
155.28 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
161 |
96.38 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
15 |
14.64 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
54 |
31.52 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
1 |
0.98 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
41 |
29 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
26 |
28.3 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
120 |
83.6 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
77 |
102.75 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
41 |
17.14 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
102 |
104.3 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
50 |
12.59 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
145 |
41.1 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
53 |
13.56 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
26 |
12.52 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
7 |
5.82 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
51 |
28.92 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
85 |
26.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
150 |
39.38 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
3 |
0.9 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00170
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch06 |
39088176 |
39088284 |
+ |
ACAUUGGUGUCCCUGUCGUU
CGUAAAUUAAAGCAUACAUG
CCCUUUCACUCUAACAAAGU
GGCAUGGGCACCAAAUGUCC
CAAAAAUAUGACGGCAGGAA
CAUCAAUGU |
-41.56 |
NA |
structure |
|