TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00170

sequenceLengthmiRNA familysRNA IDtarget
AUAUGACGGCAGGAACAUCAAUGU24NA S09954219NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 3 0.29
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 3 0.4
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 2 0.23
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 2 0.43
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 9 0.66
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 205 157.98
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 179 135.79
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 194 138.21
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 221 162.76
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 176 109.9
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 194 123.59
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 250 164.76
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 254 155.28
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 161 96.38
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 15 14.64
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 54 31.52
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 1 0.98
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 41 29
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 26 28.3
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 120 83.6
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 77 102.75
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 41 17.14
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 102 104.3
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 50 12.59
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 145 41.1
S0712 Solanum lycopersicum MicroTom fruit , mature green 53 13.56
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 26 12.52
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 7 5.82
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 51 28.92
S0708 Solanum lycopersicum MicroTom flower, open 85 26.23
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 150 39.38
S0372 Solanum lycopersicum Heinz 1706 flower 1 0.3
S0371 Solanum lycopersicum Heinz 1706 leaf 3 0.9

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00170

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch06 39088176 39088284 + ACAUUGGUGUCCCUGUCGUU
CGUAAAUUAAAGCAUACAUG
CCCUUUCACUCUAACAAAGU
GGCAUGGGCACCAAAUGUCC
CAAAAAUAUGACGGCAGGAA
CAUCAAUGU		 -41.56 NA structure