Tomato miRNA M00174
| sequence | Length | miRNA family | sRNA ID | target |
| UGGACGGCGAGGACAUGAGUGAAC | 24 | NA |
S23636861 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
241 |
185.72 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
173 |
131.24 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
142 |
101.17 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
140 |
103.11 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
143 |
89.29 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
157 |
100.02 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
153 |
100.83 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
200 |
122.27 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
290 |
173.6 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
14 |
13.66 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
31 |
18.1 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
20 |
19.62 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
18 |
12.73 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
52 |
56.61 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
65 |
62.1 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
18 |
52 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
131 |
91.26 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
124 |
165.47 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
9 |
3.76 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
15 |
15.34 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
30 |
7.55 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
43 |
12.19 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
50 |
12.79 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
63 |
30.35 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
35 |
29.08 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
52 |
29.48 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
18 |
5.55 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
86 |
22.58 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00174
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch02 |
33638943 |
33638831 |
- |
GUUCACUCAUGUUUUCGCCA
UCCAACUUUUGGUUCAUGUA
UGUCCAACAUGGCAACUAAC
GCCUAUAAAGGCAUAUUUGC
ACCAAAAGUUGGACGGCGAG
GACAUGAGUGAAC |
-67.40 |
NA |
structure |
|