TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00174

sequenceLengthmiRNA familysRNA IDtarget
UGGACGGCGAGGACAUGAGUGAAC24NA S23636861NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 241 185.72
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 173 131.24
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 142 101.17
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 140 103.11
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 143 89.29
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 157 100.02
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 153 100.83
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 200 122.27
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 290 173.6
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 14 13.66
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 31 18.1
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 20 19.62
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 18 12.73
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 52 56.61
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 65 62.1
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 18 52
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 131 91.26
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 124 165.47
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 9 3.76
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 15 15.34
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 30 7.55
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 43 12.19
S0712 Solanum lycopersicum MicroTom fruit , mature green 50 12.79
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 63 30.35
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 35 29.08
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 52 29.48
S0708 Solanum lycopersicum MicroTom flower, open 18 5.55
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 86 22.58

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00174

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy		miRNA*structure
SL2.40ch02 33638943 33638831 - GUUCACUCAUGUUUUCGCCA
UCCAACUUUUGGUUCAUGUA
UGUCCAACAUGGCAACUAAC
GCCUAUAAAGGCAUAUUUGC
ACCAAAAGUUGGACGGCGAG
GACAUGAGUGAAC		 -67.40 NA structure