Tomato miRNA M00177
| sequence | Length | miRNA family | sRNA ID | target |
| AGAAUAGUUGGCUCAUUAGGUUAA | 24 | NA |
S06121010 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
41 |
4.79 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
6 |
1.29 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
69 |
5.09 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
2 |
1.54 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
1 |
0.76 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
7 |
4.99 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
7 |
5.16 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
2 |
1.25 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
6 |
3.82 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
6 |
3.95 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
7 |
4.28 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
7 |
4.19 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
42 |
40.98 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
41 |
23.93 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
6 |
5.89 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
10 |
7.07 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
55 |
59.87 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
208 |
198.73 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
10 |
28.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
4 |
2.79 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2 |
0.84 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
3 |
0.76 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
4 |
1.02 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
72 |
22.22 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
13 |
3.41 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
16 |
4.79 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
28 |
8.47 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
26 |
7.83 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00177
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch03 |
63515431 |
63515513 |
+ |
UUAGCUUAAUGAACAAGCUA
UUCUUUAAUUAGGGAAUCGA
AAACCAAUUUCCUAUUUAAA
GAAUAGUUGGCUCAUUAGGU
UAA |
-35.30 |
NA |
structure |
|