TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00177

sequenceLengthmiRNA familysRNA IDtarget
AGAAUAGUUGGCUCAUUAGGUUAA24NA S06121010NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 1 0.13
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 41 4.79
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 6 1.29
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 69 5.09
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 2 1.54
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 1 0.76
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 7 4.99
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 7 5.16
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 2 1.25
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 6 3.82
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 6 3.95
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 7 4.28
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 7 4.19
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 42 40.98
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 41 23.93
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 6 5.89
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 10 7.07
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 55 59.87
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 208 198.73
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 10 28.89
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 4 2.79
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 2 0.84
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 3 0.76
S0712 Solanum lycopersicum MicroTom fruit , mature green 4 1.02
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 2 0.96
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 5 4.15
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 3 1.7
S0708 Solanum lycopersicum MicroTom flower, open 72 22.22
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 13 3.41
S0373 Solanum lycopersicum Heinz 1706 fruit 16 4.79
S0372 Solanum lycopersicum Heinz 1706 flower 28 8.47
S0371 Solanum lycopersicum Heinz 1706 leaf 26 7.83

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00177

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch03 63515431 63515513 + UUAGCUUAAUGAACAAGCUA
UUCUUUAAUUAGGGAAUCGA
AAACCAAUUUCCUAUUUAAA
GAAUAGUUGGCUCAUUAGGU
UAA
-35.30 NA structure