Tomato Functional Genomics Database (TFGD)

Tomato miRNA M00180

sequence	Length	miRNA family	sRNA ID	target
AGCUGACGGCAUUAGAUUGAUAUA	24	NA	S07306402	NA

Digital expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	6	0.44
S0734	Solanum lycopersicum	IL8-3-1	seedlings, two-week-old	101	77.83
S0733	Solanum lycopersicum	IL8-3	seedlings, two-week-old	114	86.48
S0732	Solanum lycopersicum	IL8-2-1	seedlings, two-week-old	70	49.87
S0731	Solanum lycopersicum	IL8-2	seedlings, two-week-old	100	73.65
S0730	Solanum lycopersicum	IL8-1-3	seedlings, two-week-old	91	56.82
S0729	Solanum lycopersicum	IL8-1D	seedlings, two-week-old	89	56.7
S0728	Solanum lycopersicum	IL8-1-1	seedlings, two-week-old	106	69.86
S0727	Solanum lycopersicum	IL2-5	seedlings, two-week-old	113	69.08
S0726	Solanum lycopersicum	IL1-1	seedlings, two-week-old	99	59.26
S0725	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate3	134	130.74
S0724	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate2	90	52.54
S0723	Solanum lycopersicum x S. pennellii	M82 x LA716 (F2)	seedlings, two-week-old , replicate1	57	55.91
S0722	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate2	57	40.31
S0721	Solanum lycopersicum x S. pennellii	M82 x LA716 (F1)	seedlings, two-week-old , replicate1	95	103.42
S0720	Solanum pennellii	LA716	seedlings, two-week-old , replicate2	126	120.39
S0719	Solanum pennellii	LA716	seedlings, two-week-old , replicate1	73	210.88
S0718	Solanum lycopersicum	M82	seedlings, two-week-old , replicate2	93	64.79
S0717	Solanum lycopersicum	M82	seedlings, two-week-old , replicate1	73	97.41
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	62	25.93
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	42	42.95
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	90	22.65
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	143	40.53
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	129	33
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	27	13.01
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	25	20.77
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	42	23.81
S0708	Solanum lycopersicum	MicroTom	flower, open	92	28.39
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	133	34.92

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00180

genome hit of precursor				precursor
sequence ID	start	end	strand	sequence	folding energy	miRNA*	structure
SL2.40ch01	5704070	5703913	-	AGCUGACGGCAUUAGAUUGA UAUAUGUUACUCACAGUAAU GUUUUACUCAUAAUACGUUA CUUACAGUAACGUUUUAGGC GUAAAACGUUACUCAAAAUA ACGUUUUAGGAGUAAAACCG UAUUUACAGUAACGUAUAUC AACCUAACACUGUUAGUU	-63.60	NA	structure