Tomato miRNA M00184
| sequence | Length | miRNA family | sRNA ID | target |
| GAUAGUACAGGUAGGAAACUCACA | 24 | NA |
S16766588 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
19 |
1.85 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
22 |
2.92 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
105 |
12.27 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
25 |
5.38 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
408 |
30.09 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2 |
0.84 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
5 |
1.54 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
10 |
2.63 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
261 |
78.12 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
881 |
266.63 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
257 |
77.44 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00184
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch04 |
1580247 |
1580113 |
- |
UGUGAGUUUUCUGUCUGUAC
UAGUAUCAAAUGCUUCGCGA
AGCAAACCUGAUUGUUCAGG
UAGGAAAAGUGAACAACUUG
UAGUUCAUUUGUGUUUCCGU
AAACAUUUGGUGAUAGUACA
GGUAGGAAACUCACA |
-63.40 |
NA |
structure |
|