TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00198

sequenceLengthmiRNA familysRNA IDtarget
AAAGUGAGACGAACAAAUUGAAUC24NA S01089748click here

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 475 46.29
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 531 70.38
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 132 15.42
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 60 12.92
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 8398 619.44
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 246 102.87
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 37 37.83
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 998 251.2
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 774 219.37
S0712 Solanum lycopersicum MicroTom fruit , mature green 2247 574.87
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 939 452.31
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 439 364.69
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 2136 1211.12
S0708 Solanum lycopersicum MicroTom flower, open 2134 658.43
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 3240 850.59
S0373 Solanum lycopersicum Heinz 1706 fruit 3308 990.13
S0372 Solanum lycopersicum Heinz 1706 flower 4498 1361.28
S0371 Solanum lycopersicum Heinz 1706 leaf 2806 845.56

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00198

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch01 831472 831535 + GGUUCAAUUUGUUUGCCCUA
CUUUACUUUUAAAGUAAAGU
AAAGUGAGACGAACAAAUUG
AAUC
-28.40 NA structure