Tomato miRNA M00198
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
475 |
46.29 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
531 |
70.38 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
132 |
15.42 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
60 |
12.92 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
8398 |
619.44 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
246 |
102.87 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
37 |
37.83 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
998 |
251.2 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
774 |
219.37 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
2247 |
574.87 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
939 |
452.31 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
439 |
364.69 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2136 |
1211.12 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2134 |
658.43 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
3240 |
850.59 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
3308 |
990.13 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4498 |
1361.28 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2806 |
845.56 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00198
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch01 |
831472 |
831535 |
+ |
GGUUCAAUUUGUUUGCCCUA
CUUUACUUUUAAAGUAAAGU
AAAGUGAGACGAACAAAUUG
AAUC |
-28.40 |
NA |
structure |
|