TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00201

sequenceLengthmiRNA familysRNA IDtarget
AGAGGCGGAGUCAGAAUUUUCAAU24NA S06648170NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 2 0.19
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 22 2.92
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 12 1.4
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 4 0.86
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 264 19.47
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 1070 824.56
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 1284 974.05
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 1971 1404.21
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 2830 2084.23
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 1761 1099.58
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 1337 851.73
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 1989 1310.85
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 1286 786.19
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 1443 863.8
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 246 240.02
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 283 165.21
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 277 271.72
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 525 371.3
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 839 913.34
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 1390 1328.08
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 771 2227.21
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 2993 2085.05
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 2537 3385.46
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 800 334.53
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 215 219.85
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 1254 315.64
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 1438 407.56
S0712 Solanum lycopersicum MicroTom fruit , mature green 1379 352.8
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 479 230.73
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 318 264.18
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 559 316.95
S0708 Solanum lycopersicum MicroTom flower, open 312 96.27
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 572 150.17
S0373 Solanum lycopersicum Heinz 1706 fruit 24 7.18
S0372 Solanum lycopersicum Heinz 1706 flower 31 9.38
S0371 Solanum lycopersicum Heinz 1706 leaf 16 4.82

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00201

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch12 6710898 6711056 + AGAGGCGGAGUCAGAAUUUU
CAAU
AAGGGGUUCAAAAUCU
GUAGAUAUAGAUAGUCAAAG
AGGGUUCGACAUCUACUAUA
AACUUAUUUUAACCAUGUAC
AAUUAAUAUAAUUUUCCUCC
GAAGGGAACCCCUUGUAUGA
AGGUAGCUCCUCCGCCCCU
-45.40 NA structure