Tomato miRNA M00202
| sequence | Length | miRNA family | sRNA ID | target |
| AGGGAUUGUAGGCAGAGAGAUGGC | 24 | NA |
S07846781 | NA |
Digital expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
188 |
18.32 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
94 |
12.46 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
32 |
3.74 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
294 |
63.31 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
3519 |
259.56 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
12644 |
9743.65 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
1875 |
1422.39 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
6507 |
4635.82 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
10817 |
7966.47 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
9286 |
5798.24 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
4531 |
2886.44 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
5440 |
3585.23 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
10324 |
6311.55 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
10887 |
6517.1 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
1395 |
1361.1 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
1881 |
1098.08 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
943 |
925.02 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
3959 |
2799.93 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
5087 |
5537.72 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1550 |
1480.96 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
827 |
2388.98 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
5499 |
3830.83 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
6333 |
8450.97 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
2362 |
987.7 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
3869 |
3956.25 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
4756 |
1197.11 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
13857 |
3927.4 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
7016 |
1794.97 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
13333 |
6422.48 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
22027 |
18298.7 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
42482 |
24087.4 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4730 |
1459.41 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
11896 |
3123.02 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
103 |
30.83 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
42 |
12.71 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
61 |
18.38 |
Hits on known miRNAs
| No hits on known miRNAs were found | Precursor of miRNA M00202
| genome hit of precursor | precursor |
| sequence ID | start | end | strand |
sequence | folding energy | miRNA* | structure |
| SL2.40ch02 |
45487028 |
45487199 |
+ |
GCCAUCUUCCUGGCUAUAUU
CCCUUGUAAAGUGUCCCUCU
UCGCCGCAUUUGUAGCAUCC
CGCUAUUCCUCCACCGCCUC
CCUGGCUACAUUCCCUUGCG
AAAGAAGGAGGGGGCUGCUA
CAAAUGUGGGGAAGAAGGGC
AUUUUGGAAGGGAUUGUAGG
CAGAGAGAUGGC |
-101.70 |
NA |
structure |
| SL2.40ch02 |
45483331 |
45483502 |
+ |
GCCAUCUUCCUGGCUAUAUU
CCCUUGUAAAGUGUCCUUCU
UGUCCGCAUUUGUAGCAUCC
CGCUCCUCCUCCACCGCCUC
CUUGGCUACAUUCCCUUGUG
AAAGAAGGAAGGGGCUGCUA
CAAAUGUGGGGAAGAAGGGC
AUUUUGGAAGGGAUUGUAGG
CAGAGAGAUGGC |
-102.20 |
NA |
structure |
|