TFGD
Home Expression Metabolite sRNA Links Contact

Tomato miRNA M00202

sequenceLengthmiRNA familysRNA IDtarget
AGGGAUUGUAGGCAGAGAGAUGGC24NA S07846781NA

Digital expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0739 Solanum lycopersicum Ailsa Craig fruit, red ripe (52 days after anthesis) 188 18.32
S0738 Solanum lycopersicum Ailsa Craig fruit, breaker (42 days after anthesis) 94 12.46
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 32 3.74
S0736 Solanum lycopersicum Ailsa Craig fruit, immature (17 days after anthesis) 294 63.31
S0735 Solanum lycopersicum Sunny leaf , TSWV-infected 3519 259.56
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 12644 9743.65
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 1875 1422.39
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 6507 4635.82
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 10817 7966.47
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 9286 5798.24
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 4531 2886.44
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 5440 3585.23
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 10324 6311.55
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 10887 6517.1
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 1395 1361.1
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 1881 1098.08
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 943 925.02
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 3959 2799.93
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 5087 5537.72
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 1550 1480.96
S0719 Solanum pennellii LA716 seedlings, two-week-old , replicate1 827 2388.98
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 5499 3830.83
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 6333 8450.97
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 2362 987.7
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 3869 3956.25
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 4756 1197.11
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 13857 3927.4
S0712 Solanum lycopersicum MicroTom fruit , mature green 7016 1794.97
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 13333 6422.48
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 22027 18298.7
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 42482 24087.4
S0708 Solanum lycopersicum MicroTom flower, open 4730 1459.41
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 11896 3123.02
S0373 Solanum lycopersicum Heinz 1706 fruit 103 30.83
S0372 Solanum lycopersicum Heinz 1706 flower 42 12.71
S0371 Solanum lycopersicum Heinz 1706 leaf 61 18.38

Hits on known miRNAs

No hits on known miRNAs were found

Precursor of miRNA M00202

genome hit of precursorprecursor
sequence IDstartendstrand sequencefolding
energy
miRNA*structure
SL2.40ch02 45487028 45487199 + GCCAUCUUCCUGGCUAUAUU
CCCUUGUAAAGUGUCCCUCU
UCGCCGCAUUUGUAGCAUCC
CGCUAUUCCUCCACCGCCUC
CCUGGCUACAUUCCCUUGCG
AAAGAAGGAGGGGGCUGCUA
CAAAUGUGGGGAAGAAGGGC
AUUUUGGAAGGGAUUGUAGG
CAGAGAGAUGGC
-101.70 NA structure
SL2.40ch02 45483331 45483502 + GCCAUCUUCCUGGCUAUAUU
CCCUUGUAAAGUGUCCUUCU
UGUCCGCAUUUGUAGCAUCC
CGCUCCUCCUCCACCGCCUC
CUUGGCUACAUUCCCUUGUG
AAAGAAGGAAGGGGCUGCUA
CAAAUGUGGGGAAGAAGGGC
AUUUUGGAAGGGAUUGUAGG
CAGAGAGAUGGC
-102.20 NA structure