Tomato sRNA S00474604
| Sequence | Length | annotation |
| AAAAUGAUCAUUAGCGGCAUUUAA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
1 |
0.22 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
76 |
5.61 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
111 |
85.54 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
78 |
59.17 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
46 |
32.77 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
37 |
27.25 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
46 |
28.72 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
111 |
70.71 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
88 |
58 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
108 |
66.03 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
101 |
60.46 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
171 |
166.84 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
430 |
251.02 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
197 |
193.24 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
575 |
406.66 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
115 |
125.19 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
133 |
127.08 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
18 |
52 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
82 |
57.12 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
22 |
29.36 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
10 |
4.18 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
7 |
1.76 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
23 |
6.52 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
15 |
3.84 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
52 |
25.05 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
48 |
39.88 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
49 |
27.78 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
70 |
21.6 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
79 |
20.74 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
4 |
1.2 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4 |
1.21 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
4 |
1.21 |
|