Tomato sRNA S00969667
| Sequence | Length | annotation |
| AAAGCUGACGGCGUUAGAUUGAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
2 |
0.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
3 |
0.35 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
7 |
0.52 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
103 |
79.37 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
36 |
27.31 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
35 |
24.94 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
47 |
34.61 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
88 |
54.95 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
68 |
43.32 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
78 |
51.41 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
77 |
47.07 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
74 |
44.3 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
153 |
149.28 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
252 |
147.11 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
161 |
157.93 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
247 |
174.69 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
60 |
65.32 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
134 |
128.03 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
82 |
236.88 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
33 |
22.99 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
43 |
57.38 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
12 |
5.02 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
13 |
13.29 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
7 |
1.76 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
23 |
6.52 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
23 |
5.88 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
13 |
6.26 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
5 |
4.15 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
15 |
8.51 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
52 |
16.04 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
132 |
34.65 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|