Tomato sRNA S01117107
| Sequence | Length | annotation |
| AAAGUUGACGGCGUUAGAUUGAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
20 |
1.48 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
123 |
94.79 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
74 |
56.14 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
51 |
36.33 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
79 |
58.18 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
122 |
76.18 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
62 |
39.5 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
76 |
50.09 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
81 |
49.52 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
80 |
47.89 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
193 |
188.31 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
252 |
147.11 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
198 |
194.23 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
227 |
160.54 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
128 |
139.34 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
282 |
269.44 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
228 |
658.63 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
68 |
47.37 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
148 |
197.5 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
61 |
25.51 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
35 |
35.79 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
66 |
16.61 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
77 |
21.82 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
39 |
9.98 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
15 |
7.23 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
44 |
13.58 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
85 |
22.31 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|