Tomato sRNA S01557172
| Sequence | Length | annotation |
| AACAACAUACUUACUGAAAUGCCA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
588 |
57.3 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1051 |
139.31 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
370 |
43.22 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
104 |
22.4 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
1127 |
83.13 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
11 |
2.77 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
8 |
2.27 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
13 |
3.33 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
7 |
3.97 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
55 |
16.97 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
33 |
8.66 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1035 |
309.79 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
772 |
233.64 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
350 |
105.47 |
|