Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AACAACAUACUUACUGAAAUGCCA	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	588	57.3
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1051	139.31
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	370	43.22
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	104	22.4
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	1127	83.13
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	11	2.77
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	8	2.27
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	13	3.33
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	2	0.96
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	1	0.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	7	3.97
S0708	Solanum lycopersicum	MicroTom	flower, open	55	16.97
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	33	8.66
S0373	Solanum lycopersicum	Heinz 1706	fruit	1035	309.79
S0372	Solanum lycopersicum	Heinz 1706	flower	772	233.64
S0371	Solanum lycopersicum	Heinz 1706	leaf	350	105.47