Tomato sRNA S02673912
| Sequence | Length | annotation |
| AAGCUGACGGCGUUAGAUUGAUAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
6 |
0.44 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
59 |
45.47 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
23 |
17.45 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
23 |
16.39 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
27 |
19.88 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
50 |
31.22 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
32 |
20.39 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
37 |
24.38 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
39 |
23.84 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
38 |
22.75 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
159 |
155.14 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
141 |
82.31 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
240 |
235.42 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
166 |
117.4 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
68 |
74.02 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
194 |
185.36 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
172 |
496.86 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
22 |
15.33 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
48 |
64.05 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
12 |
5.02 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
6 |
6.14 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
12 |
3.02 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
19 |
5.39 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
18 |
4.61 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
19 |
9.15 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
2 |
1.66 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
11 |
6.24 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
19 |
5.86 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
69 |
18.11 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|