Tomato sRNA S02840588
| Sequence | Length | annotation |
| AAGGGAUUGUAGGCAGAGAGAUGG | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
24 |
1.77 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
163 |
125.61 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
23 |
17.45 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
93 |
66.26 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
122 |
89.85 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
139 |
86.79 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
65 |
41.41 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
93 |
61.29 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
164 |
100.26 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
174 |
104.16 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
37 |
36.1 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
34 |
19.85 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
17 |
16.68 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
50 |
35.36 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
62 |
67.49 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
35 |
33.44 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
21 |
60.66 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
21 |
14.63 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
72 |
96.08 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
15 |
6.27 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
5 |
5.11 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
24 |
6.04 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
77 |
21.82 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
48 |
12.28 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
187 |
90.08 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
351 |
291.59 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
738 |
418.45 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
75 |
23.14 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
172 |
45.15 |
|