Tomato sRNA S03156023
| Sequence | Length | annotation |
| AAGUUGACGGCGUUAGAUUGAUAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
7 |
0.52 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
86 |
66.27 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
84 |
63.72 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
68 |
48.45 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
90 |
66.28 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
114 |
71.18 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
65 |
41.41 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
80 |
52.72 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
80 |
48.91 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
78 |
46.69 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
101 |
98.55 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
137 |
79.98 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
105 |
103 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
181 |
128.01 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
100 |
108.86 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
218 |
208.29 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
138 |
398.64 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
84 |
58.52 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
146 |
194.83 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
46 |
19.24 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
17 |
17.38 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
48 |
12.08 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
28 |
7.94 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
27 |
6.91 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
13 |
6.26 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
6 |
4.98 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
23 |
13.04 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
32 |
9.87 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
101 |
26.52 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
2 |
0.6 |
|