Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AAUACAACUAUAGCCAAGACAA	22	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	250	24.36
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	417	55.27
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	118	13.79
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	4	0.86
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	2229	164.41
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	2	2.05
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	10	2.52
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	8	2.05
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	2	0.96
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	3	1.7
S0708	Solanum lycopersicum	MicroTom	flower, open	13	4.01
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	6	1.58
S0373	Solanum lycopersicum	Heinz 1706	fruit	425	127.21
S0372	Solanum lycopersicum	Heinz 1706	flower	261	78.99
S0371	Solanum lycopersicum	Heinz 1706	leaf	611	184.12