Tomato sRNA S03299510
| Sequence | Length | annotation |
| AAUACAACUAUAGCCAAGACAA | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
250 |
24.36 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
417 |
55.27 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
118 |
13.79 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
4 |
0.86 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
2229 |
164.41 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
2 |
2.05 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
10 |
2.52 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
8 |
2.05 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
3 |
1.7 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
13 |
4.01 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
6 |
1.58 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
425 |
127.21 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
261 |
78.99 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
611 |
184.12 |
|