Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
ACAUGGACAAGUAAAUAGGGACGG	24	miRNA

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	8	0.78
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	1	0.12
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	6	0.44
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	67	28.02
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	137	140.09
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	108	27.18
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	334	94.66
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	146	37.35
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	24	11.56
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	11	9.14
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	9	5.1
S0708	Solanum lycopersicum	MicroTom	flower, open	28	8.64
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	36	9.45