Tomato sRNA S04774071
| Sequence | Length | annotation |
| ACAUGGCAGGAAGACAUGAGGCAU | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
1 |
0.12 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
113 |
87.08 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
46 |
34.9 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
42 |
29.92 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
87 |
64.07 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
110 |
68.68 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
106 |
67.53 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
131 |
86.34 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
149 |
91.09 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
213 |
127.5 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
21 |
20.49 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
125 |
72.97 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
28 |
27.47 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
66 |
46.68 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
15 |
16.33 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1 |
0.96 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
44 |
30.65 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
33 |
44.04 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
3 |
1.25 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
12 |
12.27 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
14 |
3.52 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
9 |
2.55 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
27 |
6.91 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
74 |
35.65 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
65 |
54 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
94 |
53.3 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
34 |
10.49 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
298 |
78.23 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
S04774071 mapped to the following genes
|