TFGD
Home Expression Metabolite sRNA Links Contact

Tomato sRNA S04774071

SequenceLengthannotation
ACAUGGCAGGAAGACAUGAGGCAU24miRNA

expression

SampleNo. raw readsRPM
IDOrganismCultivarTissue
S0737 Solanum lycopersicum Ailsa Craig fruit, mature green (39 days after anthesis) 1 0.12
S0734 Solanum lycopersicum IL8-3-1 seedlings, two-week-old 113 87.08
S0733 Solanum lycopersicum IL8-3 seedlings, two-week-old 46 34.9
S0732 Solanum lycopersicum IL8-2-1 seedlings, two-week-old 42 29.92
S0731 Solanum lycopersicum IL8-2 seedlings, two-week-old 87 64.07
S0730 Solanum lycopersicum IL8-1-3 seedlings, two-week-old 110 68.68
S0729 Solanum lycopersicum IL8-1D seedlings, two-week-old 106 67.53
S0728 Solanum lycopersicum IL8-1-1 seedlings, two-week-old 131 86.34
S0727 Solanum lycopersicum IL2-5 seedlings, two-week-old 149 91.09
S0726 Solanum lycopersicum IL1-1 seedlings, two-week-old 213 127.5
S0725 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate3 21 20.49
S0724 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate2 125 72.97
S0723 Solanum lycopersicum x S. pennellii M82 x LA716 (F2) seedlings, two-week-old , replicate1 28 27.47
S0722 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate2 66 46.68
S0721 Solanum lycopersicum x S. pennellii M82 x LA716 (F1) seedlings, two-week-old , replicate1 15 16.33
S0720 Solanum pennellii LA716 seedlings, two-week-old , replicate2 1 0.96
S0718 Solanum lycopersicum M82 seedlings, two-week-old , replicate2 44 30.65
S0717 Solanum lycopersicum M82 seedlings, two-week-old , replicate1 33 44.04
S0716 Solanum lycopersicum MicroTom fruit , 7 days post breaker 3 1.25
S0715 Solanum lycopersicum MicroTom fruit , 5 days post breaker 12 12.27
S0714 Solanum lycopersicum MicroTom fruit , 3 days post breaker 14 3.52
S0713 Solanum lycopersicum MicroTom fruit , breaker stage 9 2.55
S0712 Solanum lycopersicum MicroTom fruit , mature green 27 6.91
S0711 Solanum lycopersicum MicroTom fruit , 11mm to 14mm in diameter 74 35.65
S0710 Solanum lycopersicum MicroTom fruit , 5mm to 7mm in diameter 65 54
S0709 Solanum lycopersicum MicroTom fruit , 1mm to 3mm in diameter 94 53.3
S0708 Solanum lycopersicum MicroTom flower, open 34 10.49
S0707 Solanum lycopersicum MicroTom flower bud, closed bud before flower blooming 298 78.23
S0372 Solanum lycopersicum Heinz 1706 flower 2 0.61

S04774071 mapped to the following genes

gene IDstart positionstop positionstrandexpression
Solyc00g144470 1190 1213 + click here
Solyc02g067130 995 1018 + click here
Solyc06g035480 1064 1087 + click here
Solyc08g066370 1343 1366 + click here
Solyc09g061650 575 598 + click here