Tomato sRNA S05770395
| Sequence | Length | annotation |
|---|
| AGAAACAACACUUGCUAAAGG | 21 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
166 |
16.18 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
770 |
102.06 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
487 |
56.89 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
118 |
25.41 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
28 |
2.07 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
2 |
0.5 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
3 |
1.45 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
3 |
2.49 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
6 |
1.58 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
3 |
0.91 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
6 |
1.81 |
|
