Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AGAAGGGGAGAUAGAUGAAGUUA	23

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	4	0.53
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	14	1.64
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	2	0.43
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	8	0.59
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	173	72.34
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	7	7.16
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	188	47.32
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	187	53
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	112	28.65
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	7	3.37
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	1	0.83
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	8	4.54
S0708	Solanum lycopersicum	MicroTom	flower, open	4	1.23
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	4	1.05
S0372	Solanum lycopersicum	Heinz 1706	flower	1	0.3