Tomato sRNA S06063222
| Sequence | Length | annotation |
| AGAAGGGGAGAUAGAUGAAGUUA | 23 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
4 |
0.53 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
14 |
1.64 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
8 |
0.59 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
173 |
72.34 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
7 |
7.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
188 |
47.32 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
187 |
53 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
112 |
28.65 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
7 |
3.37 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1 |
0.83 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
8 |
4.54 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
4 |
1.23 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
4 |
1.05 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
|