Tomato sRNA S06164317
| Sequence | Length | annotation |
| AGAAUGUUGUCUGGUUCGAAA | 21 | |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
6 |
0.58 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
75 |
8.76 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
26 |
5.6 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
268 |
19.77 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
2 |
0.62 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
19 |
5.69 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
111 |
33.59 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
261 |
78.65 |
|