Tomato sRNA S07306443
| Sequence | Length | annotation |
| AGCUGACGGCGUUAGAUUGAUAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
15 |
1.11 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
416 |
320.58 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
161 |
122.14 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
184 |
131.09 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
200 |
147.3 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
363 |
226.66 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
219 |
139.51 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
221 |
145.65 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
270 |
165.06 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
249 |
149.05 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
479 |
467.36 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
453 |
264.45 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
415 |
407.09 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
758 |
536.08 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
363 |
395.16 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1022 |
976.48 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
499 |
1441.48 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
214 |
149.08 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
297 |
396.33 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
32 |
13.38 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
16 |
16.36 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
58 |
14.6 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
92 |
26.07 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
101 |
25.84 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
29 |
13.97 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
10 |
8.31 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
45 |
25.52 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
138 |
42.58 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
208 |
54.61 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
1 |
0.3 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
1 |
0.3 |
|