Tomato sRNA S07846779
| Sequence | Length | annotation |
| AGGGAUUGUAGGCAGAGAGAUG | 22 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
2 |
0.43 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
89 |
6.56 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
92 |
70.9 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
9 |
6.83 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
13 |
9.26 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
130 |
95.74 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
38 |
23.73 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
14 |
8.92 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
54 |
35.59 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
94 |
57.47 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
33 |
19.75 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
4 |
3.9 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
8 |
4.67 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
5 |
4.9 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
10 |
7.07 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
38 |
41.37 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
16 |
15.29 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
10 |
28.89 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
44 |
30.65 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
60 |
80.07 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
153 |
63.98 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
117 |
119.64 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
305 |
76.77 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
774 |
219.37 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
389 |
99.52 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
784 |
377.65 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
1234 |
1025.13 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
2518 |
1427.71 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
311 |
95.96 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
924 |
242.57 |
|