Tomato sRNA S08090164
| Sequence | Length | annotation |
|---|
| AGGUGUCUAGAUGUGCAUACUCAA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
|---|
| ID | Organism | Cultivar | Tissue |
|---|
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
32 |
3.74 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
27 |
1.99 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
12 |
9.25 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
8 |
6.07 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
32 |
22.8 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
28 |
20.62 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
34 |
21.23 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
10 |
6.37 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
9 |
5.93 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
13 |
7.95 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
13 |
7.78 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
49 |
47.81 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
114 |
66.55 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
45 |
44.14 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
153 |
108.21 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
30 |
32.66 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
83 |
79.3 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
9 |
26 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
19 |
13.24 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
4 |
5.34 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
5 |
1.42 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
2 |
0.96 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
1 |
0.57 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
10 |
3.09 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
5 |
1.31 |
| S0373 |
Solanum lycopersicum |
Heinz 1706 |
fruit |
7 |
2.1 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
9 |
2.72 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
8 |
2.41 |
|
