Tomato sRNA S08637554
| Sequence | Length | annotation |
| AGUUGACGGCGUUAGAUUGAUAUA | 24 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
2 |
0.23 |
| S0736 |
Solanum lycopersicum |
Ailsa Craig |
fruit, immature (17 days after anthesis) |
3 |
0.65 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
9 |
0.66 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
801 |
617.26 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
677 |
513.58 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
775 |
552.14 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
990 |
729.11 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
1285 |
802.36 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
770 |
490.52 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
784 |
516.7 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
1109 |
677.98 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
901 |
539.35 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
274 |
267.34 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
475 |
277.29 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
199 |
195.21 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
465 |
328.86 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
632 |
688 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
1250 |
1194.32 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
865 |
2498.75 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
888 |
618.62 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
1160 |
1547.94 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
296 |
123.78 |
| S0715 |
Solanum lycopersicum |
MicroTom |
fruit , 5 days post breaker |
96 |
98.16 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
322 |
81.05 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
433 |
122.72 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
383 |
97.99 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
115 |
55.4 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
72 |
59.81 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
162 |
91.85 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
526 |
162.29 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
898 |
235.75 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
4 |
1.21 |
| S0371 |
Solanum lycopersicum |
Heinz 1706 |
leaf |
4 |
1.21 |
|