Tomato Functional Genomics Database (TFGD)

Sequence	Length	annotation
AUCACGAUGUAGGCUCAGGCUA	22

expression

Sample				No. raw reads	RPM
ID	Organism	Cultivar	Tissue	No. raw reads	RPM
S0739	Solanum lycopersicum	Ailsa Craig	fruit, red ripe (52 days after anthesis)	5	0.49
S0738	Solanum lycopersicum	Ailsa Craig	fruit, breaker (42 days after anthesis)	1	0.13
S0737	Solanum lycopersicum	Ailsa Craig	fruit, mature green (39 days after anthesis)	136	15.89
S0736	Solanum lycopersicum	Ailsa Craig	fruit, immature (17 days after anthesis)	21	4.52
S0735	Solanum lycopersicum	Sunny	leaf , TSWV-infected	112	8.26
S0716	Solanum lycopersicum	MicroTom	fruit , 7 days post breaker	34	14.22
S0715	Solanum lycopersicum	MicroTom	fruit , 5 days post breaker	3	3.07
S0714	Solanum lycopersicum	MicroTom	fruit , 3 days post breaker	39	9.82
S0713	Solanum lycopersicum	MicroTom	fruit , breaker stage	50	14.17
S0712	Solanum lycopersicum	MicroTom	fruit , mature green	35	8.95
S0711	Solanum lycopersicum	MicroTom	fruit , 11mm to 14mm in diameter	34	16.38
S0710	Solanum lycopersicum	MicroTom	fruit , 5mm to 7mm in diameter	7	5.82
S0709	Solanum lycopersicum	MicroTom	fruit , 1mm to 3mm in diameter	22	12.47
S0708	Solanum lycopersicum	MicroTom	flower, open	6	1.85
S0707	Solanum lycopersicum	MicroTom	flower bud, closed bud before flower blooming	99	25.99
S0373	Solanum lycopersicum	Heinz 1706	fruit	42	12.57
S0372	Solanum lycopersicum	Heinz 1706	flower	24	7.26
S0371	Solanum lycopersicum	Heinz 1706	leaf	53	15.97