Tomato sRNA S10952602
| Sequence | Length | annotation |
| AUGAUCAUUAGCGGCAUUUAAUU | 23 | miRNA |
expression
| Sample | No. raw reads | RPM |
| ID | Organism | Cultivar | Tissue |
| S0739 |
Solanum lycopersicum |
Ailsa Craig |
fruit, red ripe (52 days after anthesis) |
1 |
0.1 |
| S0738 |
Solanum lycopersicum |
Ailsa Craig |
fruit, breaker (42 days after anthesis) |
1 |
0.13 |
| S0737 |
Solanum lycopersicum |
Ailsa Craig |
fruit, mature green (39 days after anthesis) |
5 |
0.58 |
| S0735 |
Solanum lycopersicum |
Sunny |
leaf , TSWV-infected |
4 |
0.3 |
| S0734 |
Solanum lycopersicum |
IL8-3-1 |
seedlings, two-week-old |
72 |
55.48 |
| S0733 |
Solanum lycopersicum |
IL8-3 |
seedlings, two-week-old |
54 |
40.96 |
| S0732 |
Solanum lycopersicum |
IL8-2-1 |
seedlings, two-week-old |
54 |
38.47 |
| S0731 |
Solanum lycopersicum |
IL8-2 |
seedlings, two-week-old |
32 |
23.57 |
| S0730 |
Solanum lycopersicum |
IL8-1-3 |
seedlings, two-week-old |
65 |
40.59 |
| S0729 |
Solanum lycopersicum |
IL8-1D |
seedlings, two-week-old |
61 |
38.86 |
| S0728 |
Solanum lycopersicum |
IL8-1-1 |
seedlings, two-week-old |
35 |
23.07 |
| S0727 |
Solanum lycopersicum |
IL2-5 |
seedlings, two-week-old |
76 |
46.46 |
| S0726 |
Solanum lycopersicum |
IL1-1 |
seedlings, two-week-old |
63 |
37.71 |
| S0725 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate3 |
111 |
108.3 |
| S0724 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate2 |
172 |
100.41 |
| S0723 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F2) |
seedlings, two-week-old , replicate1 |
111 |
108.88 |
| S0722 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate2 |
135 |
95.48 |
| S0721 |
Solanum lycopersicum x S. pennellii |
M82 x LA716 (F1) |
seedlings, two-week-old , replicate1 |
72 |
78.38 |
| S0720 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate2 |
56 |
53.51 |
| S0719 |
Solanum pennellii |
LA716 |
seedlings, two-week-old , replicate1 |
18 |
52 |
| S0718 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate2 |
58 |
40.41 |
| S0717 |
Solanum lycopersicum |
M82 |
seedlings, two-week-old , replicate1 |
26 |
34.7 |
| S0716 |
Solanum lycopersicum |
MicroTom |
fruit , 7 days post breaker |
8 |
3.35 |
| S0714 |
Solanum lycopersicum |
MicroTom |
fruit , 3 days post breaker |
24 |
6.04 |
| S0713 |
Solanum lycopersicum |
MicroTom |
fruit , breaker stage |
12 |
3.4 |
| S0712 |
Solanum lycopersicum |
MicroTom |
fruit , mature green |
19 |
4.86 |
| S0711 |
Solanum lycopersicum |
MicroTom |
fruit , 11mm to 14mm in diameter |
21 |
10.12 |
| S0710 |
Solanum lycopersicum |
MicroTom |
fruit , 5mm to 7mm in diameter |
18 |
14.95 |
| S0709 |
Solanum lycopersicum |
MicroTom |
fruit , 1mm to 3mm in diameter |
21 |
11.91 |
| S0708 |
Solanum lycopersicum |
MicroTom |
flower, open |
50 |
15.43 |
| S0707 |
Solanum lycopersicum |
MicroTom |
flower bud, closed bud before flower blooming |
34 |
8.93 |
| S0372 |
Solanum lycopersicum |
Heinz 1706 |
flower |
2 |
0.61 |
|